michellemartin michellemartin

20-12-2017
Mathematics

contestada

You do not need to flip the inequality sign when solving the inequality -3t + 7 ≥ 9. True False

Respuesta :

ddwzinc ddwzinc

20-12-2017

Hello!

It is False because t is multiplied by a negative number, so to solve for it you will need to divide both sides by -3 which mean you have to flip the sign.

Hope this helps!

Answer Link

ACCESS MORE ACCESS MORE ACCESS MORE ACCESS MORE

Otras preguntas

I NEED THIS AS SOON AS POSIBLE write an essay that analyzes how the Allen's rhetorical choices advance his perspective on the state of black people in 18th-cen

Do you want to go dancing saturday? Write two sentences in Spanish explaining that you have different plans. Use the verb form poder.

Which is one way the author connects the readers to the past in "A Friend in Need"? She places historical events in a modern setting. She reports only true even

Kimberly scored a total of 35.08 points in four events fro her gymnastic competition.If she scored the same amount in each event,how many points did she score e

Round the following number to four significant figures and express the result in standard exponential notation: 442,722 * 4 points 442,700 0.4427 × 10⁶ 44.27 ×

Based on the picture below, which picture shows a climax community?* (1 Bare rock, no vegetation Grasses and herbs Fast-growing shrubs Forest of spruce Initiall

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

*WILL GIVE A BRAINIEST TO THE CORRECT ANSWER & 15 POINTS* A sodium atom has the following electron configuration: 2-7-1-1. This is the excited state because

You are giving a rectangle with dimensions of: length = 60 inches and width = 4j. The perimeter of the rectangle is 400 inches. What is the values of j?

Suppose two individuals, one from suburbia and the other from the inner city, showed the same patter of aggressive and paranoid behavior. In diagnosing these tw