nanaornot12 nanaornot12

21-02-2020
English

contestada

Why did Aristotle propose a geocentric model of the solar system?

Respuesta :

annie1799 annie1799

21-02-2020

Answer:

Because unlike other scientists at his time, he believed the Earth was the center of the universe. The opposite of the geocentric model is the heliocentric, where the Sun is the center of the universe (correct model).

Answer Link

ACCESS MORE ACCESS MORE ACCESS MORE ACCESS MORE

Otras preguntas

between 1995 and 2006, the population of samburg, usa(in thousands) can be modeled by f(x) = 0.35x(squared) - 2.1x+15.8 where x=0 represents 1995. Based on thi

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

The American Revolution subsequently inspired nineteenth-century independence movements in which part of the world? Latin America and the Caribbean Eastern Eur

True or false proteins are used to build and maintain body tissues.

Jamil always throws loose change into a pencil holder on his desk and takes it out every two weeks. This time it is all nickels and dimes. There are 7 times as

Which of the following scenarios illustrates what might have taken place at a southern state polling center in the wake of the ratification of the Fifteenth Ame

The blue dress, fraying at its seams, snagged on the brambles in the dark woods. what is the participial phrase

As commander in chief , the president ha athe power to

Which of the following best defines over-the-counter medications? a. medications that require a written order from a doctor b. drugs that can be purchased at

Why do all shareholders agree on the same goal for the financial manager??